PIK3CA-H1047R & -D350N 50% AF FFPE Reference Standard curl

PIK3CA-H1047R & -D350N 50% AF FFPE Reference Standard curl ist ein hervorragend charakterisiertes humanes FFPE-Material, das aus einer menschlichen Zelllinie erzeugt wurde. Hergestellt für FFPE (Gewebe)-Tests in Ihrem Diagnostiklabor oder Ihrer F&E-Abteilung. Informationen über den Mutationsstatus weiterer Gene finden sie auf dieser Produktseite frei zugänglich.

Artikelnummer: SID-000102 Kategorie:


Diese Produkte sind in idealer Weise geeignet für digitale PCR und/oder Next Generation Sequencing (NGS). Insbesondere zur
– Validierung und Entwicklung von Sequenzierprotokollen (z.B. Amplicon Sequencierung) und PCR-Protokollen
– zur Bestimmung der Nachweisgrenze der Methode
– zur Extraktionskontrolle

– routinemäßige Leistungsüberwachung (Nur für Forschungszwecke)


Format: FFPE (Formalin Fixed Paraffin Embedded)

Menge pro Verkaufseinheit: 1 FFPE Schnitt in einem Röhrchen (gerollt)

Erwartete DNA Menge pro Röhrchen: ≥ 400 ng / Schnitt bei Verwendung von Qiagen AllPrep DNA/RNA FFPE kit

Erwartete RNA Menge pro Röhrchen: ≥ 400 ng / Schnitt bei Verwendung von Qiagen AllPrep DNA/RNA FFPE kit

Schnittdicke: 10 µm


62 krebsrelevante Mutationen in 57 Genen. Liste der mutierten Gene mit spezifischen Mutationen im Anhang unter Dokumente.

Getestet für PIK3CA-H1047R (HGVS: c.3140A>G) & PIK3CA-D350N (HGVS: c.1048G>A) mit ddPCR zur präzisen Bestimmung der Allelfrequenz.

Das Genom wurde sequenziert und mittels ddPCR orthogenal auf spezifische Mutationen getestet.


PIK3CA-H1047R = 50% (gemessen via ddPCR)

PIK3CA-D350N ~ 50% (laut Sequenzierbericht)

Lagerung: 2-8 °C

Haltbarkeit: 24 Monate nach Herstellungsdatum

Qualitätssicherung (DNA)

Allelfrequenz/Kopienzahl (metrologisch rückverfolgbar): ddPCR (Bio-Rad)

Quantifizierung (metrologisch rückverfolgbar): fluorometrische dsDNA Messung (QuBit)

DNA Quality: Agarose Gelelectrophorese

Qualitätssicherung (RNA)

Quantifizierung: fluorometrische RNA Messung (Qubit)

Qualitätssicherung (weitere)


1. Visuell über Durchlichtmikroskopie

2. kalibrierte Messung

Technischer Hintergrund

humane Zelllinie




Certificate of Analysis (COA):

LOT: 00062

Safety Data Sheet (SDS):

Instructions For Use (IFU)

Zusätzlich enthaltene Mutationen

Zusätzliche Mutationen:

  • in 740 Genen
  • davon 57 tumorrelevante Gene
  • 806 Mutationen gesamt
  • 582 Nonsens Mutationen

Übersicht der tumorrelevanten Gene


Liste aller Mutationen

Hugo Symbol Chr Start Position End Position Variant Classification Variant Type Reference Allele Tumor Seq Allele Protein Change Cancer Gene?
AFF4 5 132270135 132270135 Missense_Mutation SNP G T p.Q208K yes
AKAP9 7 91690733 91690733 Missense_Mutation SNP G A p.E1933K yes
AMER1 0 63411453 63411453 Missense_Mutation SNP C T p.E572K yes
ATP1A1 1 116943589 116943589 Silent SNP C T p.R893R yes
BCORL1 0 129147530 129147530 Missense_Mutation SNP C T p.A261V yes
BIRC6 2 32738128 32738128 Missense_Mutation SNP C G p.S3492C yes
BRD4 19 15383805 15383805 Nonsense_Mutation SNP G A p.Q36* yes
BTK 0 100612539 100612539 Nonsense_Mutation SNP G A p.Q379* yes
CBLB 3 105452918 105452918 Missense_Mutation SNP C T p.D380N yes
CCND1 11 69462844 69462844 Silent SNP C T p.S219S yes
CDH1 16 68847282 68847282 Missense_Mutation SNP G A p.D402N yes
CDH17 8 95186459 95186459 Missense_Mutation SNP C A p.D152Y yes
CDKN2A 9 21971153 21971153 Missense_Mutation SNP C T p.E69K yes
CIC 19 42777141 42777141 Silent SNP G A p.E402E yes
CSMD3 8 113317009 113317009 Missense_Mutation SNP G A p.S2736F yes
CTNND1 11 57576833 57576833 Missense_Mutation SNP C G p.S777C yes
CUX1 7 101891859 101891859 Missense_Mutation SNP C T p.T1352I yes
CUX1 7 101877426 101877426 Silent SNP G C p.L1176L yes
ERBB4 2 212587251 212587251 Missense_Mutation SNP C T p.M250I yes
FAT1 4 187584663 187584663 Missense_Mutation SNP C G p.E1124Q yes
FGFR3 4 1805544 1805544 Silent SNP G A p.A352A yes
FLI1 11 128651905 128651905 Missense_Mutation SNP G C p.L214F yes
GRM3 7 86415653 86415653 Missense_Mutation SNP C T p.S182L yes
HNRNPA2B1 7 26237460 26237460 Missense_Mutation SNP C G p.E11D yes
LRIG3 12 59283864 59283864 Silent SNP G A p.A191A yes
MAP2K1 15 66774131 66774131 Missense_Mutation SNP G A p.E203K yes
MECOM 3 169099011 169099011 Silent SNP C T p.Q113Q yes
MUC16 19 9057612 9057612 Nonsense_Mutation SNP G T p.S9945* yes
MUC4 3 195512484 195512484 Missense_Mutation SNP G T p.D1989E yes
MUC4 3 195507159 195507159 Silent SNP G A p.T3764T yes
MYH11 16 15820795 15820797 In_Frame_Del DEL CTT p.K1256del yes
NCOR1 17 15950362 15950362 Silent SNP G A p.F2194F yes
NCOR2 12 124885084 124885084 Silent SNP G A p.S592S yes
NTRK1 1 156844394 156844394 Silent SNP G A p.E409E yes
NUMA1 11 71724367 71724367 Frame_Shift_Del DEL T p.G1394fs yes
PDE4DIP 1 145075742 145075742 Nonsense_Mutation SNP G A p.Q41* yes
PDE4DIP 1 144946723 144946723 Nonsense_Mutation SNP G A p.Q180* yes
PIK3CA 3 178952085 178952085 Missense_Mutation SNP A G p.H1047R yes
PIK3CA 3 178921566 178921566 Missense_Mutation SNP G A p.D350N yes
PPFIBP1 12 27842010 27842010 Missense_Mutation SNP G T p.K859N yes
PTEN 10 89720741 89720741 Nonsense_Mutation SNP C T p.Q298* yes
PTEN 10 89717733 89717733 Missense_Mutation SNP T A p.I253N yes
PTPN13 4 87653589 87653589 Missense_Mutation SNP G A p.E549K yes
PTPRC 1 198711079 198711079 Missense_Mutation SNP C T p.H827Y yes
RAF1 3 12627284 12627284 Missense_Mutation SNP C T p.E478K yes
RALGDS 9 135982665 135982665 Missense_Mutation SNP G A p.P407L yes
RBM15 1 110884303 110884303 Missense_Mutation SNP C T p.A759V yes
RFWD3 16 74660421 74660421 Silent SNP C G p.L667L yes
RHOA 3 49412973 49412973 Missense_Mutation SNP C T p.G17E yes
ROBO2 3 77612470 77612470 Missense_Mutation SNP G C p.E558Q yes
SMARCA4 19 11129645 11129645 Missense_Mutation SNP C G p.N817K yes
SPECC1 17 20156897 20156897 Nonsense_Mutation SNP C G p.S893* yes
TBX3 12 115109739 115109739 Missense_Mutation SNP C G p.E713D yes
TET1 10 70333991 70333993 In_Frame_Del DEL TGT p.V635del yes
TNC 9 117798406 117798406 Missense_Mutation SNP C T p.S1876N yes
TP53 17 7578179 7578179 Missense_Mutation SNP C T p.E224K yes
TPR 1 186307307 186307307 Missense_Mutation SNP C T p.R1407K yes
TRIM24 7 138268662 138268662 Missense_Mutation SNP A G p.E954G yes
TSHR 14 81609283 81609283 Splice_Site SNP G A yes
WT1 11 32439158 32439158 Silent SNP G C p.T93T yes
ZNF429 19 21724622 21724622 Missense_Mutation SNP T C p.Y95H yes
ZNF521 18 22805237 22805237 Missense_Mutation SNP G A p.S882F yes
AADAT 4 171008400 171008400 Splice_Site SNP C G no/unknown
ABCA13 7 48315837 48315837 Missense_Mutation SNP C G p.Q2192E no/unknown
ABCA4 1 94480110 94480110 Missense_Mutation SNP C G p.E1817Q no/unknown
ABCA6 17 67080435 67080435 Missense_Mutation SNP G A p.T1441M no/unknown
ABCA7 19 1054206 1054206 Missense_Mutation SNP G A p.E1198K no/unknown
ABCA7 19 1047623 1047623 Missense_Mutation SNP G A p.A747T no/unknown
ABCA8 17 66929322 66929322 Missense_Mutation SNP G A p.A186V no/unknown
ABCA9 17 67024766 67024766 Missense_Mutation SNP C T p.E509K no/unknown
ABCG2 4 89061143 89061143 Missense_Mutation SNP G A p.S2F no/unknown
ABHD17C 15 80988130 80988130 Silent SNP C T p.L120L no/unknown
ACOT12 5 80689829 80689829 Missense_Mutation SNP G C p.I35M no/unknown
ACSF2 17 48541268 48541268 Missense_Mutation SNP G C p.G379A no/unknown
ADAM19 5 156957824 156957824 Missense_Mutation SNP C T p.R133Q no/unknown
ADAMTS10 19 8670523 8670523 Missense_Mutation SNP C T p.A25T no/unknown
ADAMTS18 16 77334279 77334279 Missense_Mutation SNP G A p.P852L no/unknown
ADAMTSL3 15 84705661 84705661 Missense_Mutation SNP A G p.K1631E no/unknown
ADAMTSL4 1 150528800 150528800 Missense_Mutation SNP C T p.R512W no/unknown
ADAMTSL4 1 150532538 150532538 Missense_Mutation SNP G A p.D1031N no/unknown
ADD1 4 2883758 2883758 Missense_Mutation SNP C T p.P110L no/unknown
ADGB 6 147057695 147057695 Missense_Mutation SNP G T p.M952I no/unknown
AFAP1 4 7857195 7857195 Nonsense_Mutation SNP G C p.S111* no/unknown
AIFM1 0 129263543 129263543 Missense_Mutation SNP G A p.H611Y no/unknown
AKAP1 17 55191930 55191930 Missense_Mutation SNP C A p.S738R no/unknown
AKAP12 6 151671006 151671006 Missense_Mutation SNP G A p.E494K no/unknown
AKAP13 15 86087185 86087185 Splice_Site SNP G A p.E221K no/unknown
AKAP8 19 15483037 15483037 Missense_Mutation SNP G C p.S328C no/unknown
ALG10B 12 38710825 38710825 Nonsense_Mutation SNP C T p.Q44* no/unknown
ALOX12B 17 7979530 7979530 Missense_Mutation SNP G A p.R499C no/unknown
ALPP 2 233244644 233244644 Missense_Mutation SNP G C p.D219H no/unknown
AMOTL2 3 134085239 134085239 Missense_Mutation SNP C T p.A358T no/unknown
ANKRD11 16 89351594 89351595 Frame_Shift_Ins INS T p.N452fs no/unknown
ANKRD13A 12 110457080 110457080 Silent SNP C T p.L227L no/unknown
ANKRD18B 9 33566427 33566427 Missense_Mutation SNP C A p.Q829K no/unknown
ANKRD36 2 97881281 97881281 Missense_Mutation SNP G C p.E1240D no/unknown
ANKRD36 2 97879335 97879335 Silent SNP A G p.G1185G no/unknown
ANLN 7 36445878 36445878 Silent SNP G A p.S192S no/unknown
ANO2 12 6030396 6030396 Missense_Mutation SNP G A p.A111V no/unknown
ANO5 11 22291867 22291867 Silent SNP G A p.L636L no/unknown
AP1M1 19 16314335 16314335 Silent SNP C A p.I36I no/unknown
APCDD1L 20 57036304 57036304 Missense_Mutation SNP C T p.E350K no/unknown
APOH 17 64213064 64213064 Missense_Mutation SNP G A p.S209L no/unknown
AREL1 14 75143385 75143385 Silent SNP C T p.P184P no/unknown
ARFGEF1 8 68112718 68112718 Silent SNP G A p.L1766L no/unknown
ARHGAP1 11 46700659 46700659 Missense_Mutation SNP G C p.I416M no/unknown
ARHGAP6 0 11160403 11160403 Missense_Mutation SNP C T p.G736E no/unknown
ARHGEF2 1 155934795 155934795 Silent SNP C T p.Q236Q no/unknown
ARID4B 1 235377092 235377092 Nonsense_Mutation SNP C T p.W611* no/unknown
ART4 12 14993722 14993722 Silent SNP C G p.L170L no/unknown
ASAP1 8 131130796 131130796 Missense_Mutation SNP G A p.A578V no/unknown
ASIC3 7 150747265 150747265 Frame_Shift_Del DEL A p.R203fs no/unknown
ASPDH 19 51015502 51015502 Silent SNP C G p.R233R no/unknown
ASPH 8 62489347 62489347 Missense_Mutation SNP C G p.R378T no/unknown
ASPM 1 197111750 197111750 Silent SNP A G p.Y544Y no/unknown
ASTN1 1 177001837 177001837 Missense_Mutation SNP A T p.V207E no/unknown
ATG2B 14 96752116 96752116 Silent SNP C T p.Q2071Q no/unknown
ATG4C 1 63284947 63284947 Missense_Mutation SNP G C p.K222N no/unknown
ATL1 14 51057782 51057782 Missense_Mutation SNP G A p.D136N no/unknown
ATOH8 2 85981390 85981390 Silent SNP C G p.L26L no/unknown
ATP10B 5 160071212 160071212 Missense_Mutation SNP C G p.E267D no/unknown
ATP10B 5 160115073 160115073 Silent SNP G C p.L3L no/unknown
ATP11C 0 138850445 138850445 Missense_Mutation SNP G A p.R792W no/unknown
ATP2B4 1 203672928 203672928 Missense_Mutation SNP G C p.Q362H no/unknown
ATP4A 19 36050915 36050915 Missense_Mutation SNP G A p.S283L no/unknown
ATP6V0D2 8 87111325 87111325 Missense_Mutation SNP G A p.E40K no/unknown
ATXN3 14 92572878 92572878 Missense_Mutation SNP C T p.E7K no/unknown
AUTS2 7 69364368 69364368 Missense_Mutation SNP C A p.H136N no/unknown
AXDND1 1 179363072 179363072 Missense_Mutation SNP C G p.R300G no/unknown
BAIAP2L1 7 97935811 97935811 Missense_Mutation SNP G A p.S394L no/unknown
BCL7C 16 30899291 30899291 Silent SNP G C p.V183V no/unknown
BMI1 10 22616947 22616947 Missense_Mutation SNP G C p.E129Q no/unknown
BSCL2 11 62458142 62458142 Silent SNP C T p.E328E no/unknown
BTNL8 5 180335869 180335869 Silent SNP C T p.L111L no/unknown
C11orf42 11 6231218 6231218 Missense_Mutation SNP C T p.R71W no/unknown
C12orf55 12 97137630 97137630 Missense_Mutation SNP C G p.S2500C no/unknown
C16orf90 16 3545396 3545396 Missense_Mutation SNP G C p.S9C no/unknown
C16orf93 16 30772938 30772938 Silent SNP C T p.A44A no/unknown
C17orf97 17 260334 260334 Silent SNP G A p.G67G no/unknown
C19orf43 19 12845326 12845326 Missense_Mutation SNP G A p.S49L no/unknown
C1ORF220 1 178514681 178514681 Missense_Mutation SNP G A p.E23K no/unknown
C1orf68 1 152692576 152692576 Missense_Mutation SNP C G p.C193W no/unknown
C20orf96 20 270287 270287 Missense_Mutation SNP C T p.E34K no/unknown
C5orf64 5 60982770 60982770 Missense_Mutation SNP C G p.S33C no/unknown
C6orf163 6 88074754 88074754 Missense_Mutation SNP G A p.M210I no/unknown
C9orf40 9 77567109 77567109 Missense_Mutation SNP G C p.S140W no/unknown
CACNA2D3 3 55038803 55038803 Missense_Mutation SNP G A p.D902N no/unknown
CAND2 3 12859237 12859237 Missense_Mutation SNP G A p.D936N no/unknown
CAPRIN1 11 34119283 34119283 Missense_Mutation SNP G T p.Q680H no/unknown
CAPZA2 7 116546384 116546385 Frame_Shift_Ins INS A p.AK165fs no/unknown
CARD9 9 139258804 139258804 Missense_Mutation SNP C T p.D521N no/unknown
CASP2 7 143001856 143001856 Missense_Mutation SNP G A p.V403M no/unknown
CCAR1 10 70547802 70547896 Splice_Site DEL TAGGTCTGAGTAATATTAAGA
p.LG1000fs no/unknown
CCDC158 4 77288563 77288563 Missense_Mutation SNP C G p.E572Q no/unknown
CCDC158 4 77288656 77288656 Missense_Mutation SNP C G p.D541H no/unknown
CCDC174 3 14695975 14695975 Missense_Mutation SNP T A p.F29I no/unknown
CCDC30 1 43004977 43004977 Missense_Mutation SNP C G p.T84R no/unknown
CCDC84 11 118869204 118869204 Missense_Mutation SNP G C p.R62P no/unknown
CCDC93 2 118764366 118764366 Silent SNP G A p.I61I no/unknown
CD163 12 7639102 7639102 Silent SNP G A p.I817I no/unknown
CD1A 1 158224927 158224927 Missense_Mutation SNP C T p.H38Y no/unknown
CD58 1 117064596 117064596 Missense_Mutation SNP C T p.R213K no/unknown
CD93 20 23065383 23065383 Nonsense_Mutation SNP C A p.E483* no/unknown
CDC5L 6 44397550 44397550 Missense_Mutation SNP A G p.Y665C no/unknown
CDH2 18 25543479 25543479 Missense_Mutation SNP C T p.D786N no/unknown
CEACAM3 19 42301666 42301666 Silent SNP G T p.G70G no/unknown
CECR2 22 18003198 18003198 Missense_Mutation SNP G C p.E174Q no/unknown
CELSR1 22 46782300 46782300 Splice_Site SNP C G p.M2246I no/unknown
CELSR3 3 48683597 48683597 Silent SNP G A p.I2463I no/unknown
CEP250 20 34090747 34090747 Missense_Mutation SNP G A p.R1517Q no/unknown
CFH 1 196709867 196709867 Silent SNP G A p.G967G no/unknown
CHD3 17 7806313 7806313 Missense_Mutation SNP C G p.I1143M no/unknown
CHRM2 7 136700147 136700147 Nonsense_Mutation SNP C T p.Q179* no/unknown
CHRNA7 15 32455466 32455466 Nonsense_Mutation SNP C A p.S307* no/unknown
CHRND 2 233398977 233398977 Missense_Mutation SNP C A p.F432L no/unknown
CHTF18 16 842453 842453 Silent SNP C T p.V447V no/unknown
CLDN8 21 31587621 31587622 Frame_Shift_Ins INS T p.S208fs no/unknown
CLMN 14 95669792 95669792 Missense_Mutation SNP G A p.H632Y no/unknown
CNDP1 18 72226663 72226663 Missense_Mutation SNP C T p.R87C no/unknown
CNST 1 246784802 246784802 Missense_Mutation SNP G C p.D151H no/unknown
CNST 1 246784841 246784841 Nonsense_Mutation SNP G T p.E164* no/unknown
CNTN2 1 205027136 205027136 Missense_Mutation SNP C T p.T53M no/unknown
CNTN6 3 1424815 1424815 Missense_Mutation SNP G A p.E786K no/unknown
CNTNAP3 9 39177411 39177411 Silent SNP G T p.I277I no/unknown
COG6 13 40297500 40297500 Missense_Mutation SNP G A p.E539K no/unknown
COL11A1 1 103356041 103356041 Missense_Mutation SNP C A p.G1441V no/unknown
COL12A1 6 75843100 75843100 Silent SNP C T p.R1901R no/unknown
COL17A1 10 105794007 105794007 Silent SNP C T p.T1284T no/unknown
COL19A1 6 70866098 70866098 Missense_Mutation SNP G C p.G720A no/unknown
COL22A1 8 139668168 139668168 Missense_Mutation SNP G A p.S1102F no/unknown
COL22A1 8 139668169 139668169 Missense_Mutation SNP A T p.S1102T no/unknown
COL4A2 13 111160425 111160425 Missense_Mutation SNP G A p.E1580K no/unknown
COL5A3 19 10108783 10108783 Missense_Mutation SNP C G p.E385Q no/unknown
COL6A2 21 47552294 47552294 Missense_Mutation SNP C G p.S963C no/unknown
COL9A1 6 70964878 70964878 Missense_Mutation SNP C T p.G529D no/unknown
CPEB4 5 173317172 173317172 Nonsense_Mutation SNP C T p.Q146* no/unknown
CPNE8 12 39079315 39079315 Silent SNP A G p.A416A no/unknown
CPOX 3 98307610 98307610 Silent SNP C T p.L300L no/unknown
CRHR2 7 30702339 30702339 Missense_Mutation SNP C T p.R223H no/unknown
CRYZL1 21 34969686 34969686 Missense_Mutation SNP T C p.D233G no/unknown
CSNK2A3 11 11374144 11374144 Missense_Mutation SNP C T p.D175N no/unknown
CUL9 6 43164391 43164391 Missense_Mutation SNP C T p.S865F no/unknown
CWC27 5 64084827 64084827 Missense_Mutation SNP G A p.E217K no/unknown
CXXC1 18 47811419 47811419 Missense_Mutation SNP C T p.D289N no/unknown
CYB5D2 17 4053237 4053237 Silent SNP C T p.L101L no/unknown
CYP4F2 19 15990167 15990167 Silent SNP C T p.S462S no/unknown
CYR61 1 86047243 86047243 Missense_Mutation SNP C G p.L87V no/unknown
CYS1 2 10206069 10206069 Missense_Mutation SNP C G p.Q111H no/unknown
DALRD3 3 49055271 49055271 Missense_Mutation SNP C G p.D165H no/unknown
DALRD3 3 49055655 49055655 Missense_Mutation SNP G T p.Q88K no/unknown
DCAF12L1 0 125685773 125685773 Silent SNP C T p.K273K no/unknown
DCAF8 1 160209896 160209901 In_Frame_Del DEL TCCTCT p.103_105EEE>E no/unknown
DCHS2 4 155156599 155156599 Missense_Mutation SNP G C p.P2614A no/unknown
DCLK1 13 36521535 36521535 Silent SNP C T p.E261E no/unknown
DDI1 11 103908682 103908682 Missense_Mutation SNP G A p.E378K no/unknown
DEFB108B 11 71544278 71544278 Frame_Shift_Del DEL C p.F13fs no/unknown
DENND1B 1 197552384 197552384 Splice_Site SNP C A no/unknown
DFNB59 2 179325921 179325921 Nonsense_Mutation SNP C T p.Q327* no/unknown
DGKI 7 137206693 137206693 Missense_Mutation SNP G A p.R723C no/unknown
DGKQ 4 961427 961427 Silent SNP C T p.T299T no/unknown
DGKQ 4 960760 960760 Missense_Mutation SNP C T p.G435S no/unknown
DIAPH3 13 60558000 60558000 Silent SNP A G p.I461I no/unknown
DMD 0 31341768 31341768 Silent SNP G C p.V3057V no/unknown
DNAH1 3 52422866 52422866 Silent SNP G A p.T3136T no/unknown
DNAH5 5 13769670 13769670 Silent SNP C T p.L3220L no/unknown
DNAJC28 21 34861007 34861007 Missense_Mutation SNP C T p.D232N no/unknown
DOCK1 10 129209164 129209164 Silent SNP G A p.E1447E no/unknown
DOCK10 2 225637973 225637973 Missense_Mutation SNP C G p.E2035D no/unknown
DOHH 19 3492330 3492330 Silent SNP G A p.F173F no/unknown
DOK7 4 3494833 3494834 Frame_Shift_Ins INS GCCT p.-375fs no/unknown
DPYSL2 8 26501100 26501100 Silent SNP C G p.S319S no/unknown
DST 6 56480612 56480612 Missense_Mutation SNP C T p.M2551I no/unknown
DST 6 56708013 56708013 De_novo_Start_OutOfFrame SNP G T no/unknown
DTYMK 2 242615556 242615556 Missense_Mutation SNP C T p.E209K no/unknown
DYNC1H1 14 102431035 102431035 Missense_Mutation SNP G A p.E3K no/unknown
DZIP1 13 96251640 96251640 Nonsense_Mutation SNP C A p.E506* no/unknown
ECE1 1 21548327 21548327 Silent SNP C T p.Q683Q no/unknown
ECI2 6 4117604 4117604 Missense_Mutation SNP C G p.D323H no/unknown
EFCAB11 14 90420952 90420952 Missense_Mutation SNP G A p.S18L no/unknown
EHBP1 2 63085619 63085619 Missense_Mutation SNP C T p.S238L no/unknown
EIF2AK1 7 6080814 6080814 Missense_Mutation SNP G C p.S276R no/unknown
ELMOD1 11 107518205 107518205 Silent SNP C T p.F144F no/unknown
ELMSAN1 14 74196658 74196658 Missense_Mutation SNP C T p.E594K no/unknown
EN1 2 119604241 119604241 Missense_Mutation SNP G A p.S168L no/unknown
ENO3 17 4856393 4856393 Missense_Mutation SNP C G p.L77V no/unknown
EPHB1 3 134851797 134851797 Silent SNP C T p.P401P no/unknown
ERF 19 42753033 42753033 Nonsense_Mutation SNP C A p.E411* no/unknown
ERICH2 2 171655372 171655372 Missense_Mutation SNP G C p.E147Q no/unknown
EVC2 4 5617223 5617223 Missense_Mutation SNP C T p.E919K no/unknown
EVPL 17 74006054 74006054 Missense_Mutation SNP C G p.E1078Q no/unknown
EXOC6B 2 72802784 72802784 Missense_Mutation SNP C G p.R228T no/unknown
EXOC7 17 74085262 74085262 Silent SNP C T p.L398L no/unknown
EXOSC2 9 133577567 133577567 Missense_Mutation SNP G A p.R181Q no/unknown
EXTL1 1 26361340 26361340 Missense_Mutation SNP C G p.L565V no/unknown
F5 1 169510434 169510434 Silent SNP G A p.L1298L no/unknown
FAM135A 6 71235452 71235452 Missense_Mutation SNP A G p.S889G no/unknown
FAM160B1 10 116602826 116602826 Missense_Mutation SNP G A p.M219I no/unknown
FAM182B 20 25755937 25755937 Missense_Mutation SNP C T p.E7K no/unknown
FAM189B 1 155218232 155218232 Missense_Mutation SNP C T p.E515K no/unknown
FAM208B 10 5772927 5772928 Frame_Shift_Ins INS A p.TK322fs no/unknown
FAM221A 7 23740426 23740426 Missense_Mutation SNP C T p.S256F no/unknown
FAM43B 1 20879740 20879740 Missense_Mutation SNP G A p.D92N no/unknown
FAM83G 17 18881303 18881303 Missense_Mutation SNP G A p.S559F no/unknown
FARP1 13 99030123 99030123 Silent SNP G A p.L149L no/unknown
FARP1 13 99045897 99045897 Splice_Site SNP G T p.R363S no/unknown
FASN 17 80040993 80040993 Splice_Site SNP T G no/unknown
FBXL19 16 30941466 30941466 Missense_Mutation SNP G C p.E308Q no/unknown
FBXO43 8 101152954 101152954 Missense_Mutation SNP G C p.L510V no/unknown
FBXW10 17 18682370 18682370 Missense_Mutation SNP A G p.Y973C no/unknown
FERMT1 20 6065827 6065827 Silent SNP C G p.L493L no/unknown
FERMT1 20 6068459 6068459 Missense_Mutation SNP C G p.D446H no/unknown
FFAR1 19 35842674 35842674 Silent SNP C T p.L74L no/unknown
FGD4 12 32772771 32772771 Missense_Mutation SNP C G p.S493C no/unknown
FGFRL1 4 1018839 1018839 Missense_Mutation SNP A C p.T407P no/unknown
FIGNL1 7 50513464 50513464 Missense_Mutation SNP G C p.Q508E no/unknown
FLG 1 152287088 152287088 Missense_Mutation SNP C G p.E92Q no/unknown
FLG2 1 152329959 152329959 Silent SNP C T p.K101K no/unknown
FLG2 1 152330045 152330045 Missense_Mutation SNP C T p.E73K no/unknown
FLJ00104 16 87736874 87736874 De_novo_Start_OutOfFrame SNP G A no/unknown
FMN2 1 240286482 240286482 Missense_Mutation SNP G A p.R540Q no/unknown
FMN2 1 240370141 240370141 Nonsense_Mutation SNP C T p.Q677* no/unknown
FMN2 1 240370866 240370866 Silent SNP G A p.A918A no/unknown
FMN2 1 240372019 240372019 Silent SNP C T p.L1303L no/unknown
FNIP2 4 159747089 159747089 Silent SNP C T p.D43D no/unknown
FREM2 13 39425140 39425140 Missense_Mutation SNP G A p.E2213K no/unknown
FRMD4B 3 69336927 69336927 Silent SNP C G p.L159L no/unknown
FURIN 15 91419541 91419541 Silent SNP G A p.S78S no/unknown
FYB 5 39202327 39202327 Missense_Mutation SNP C T p.E246K no/unknown
G6PC 17 41062995 41062995 Missense_Mutation SNP A G p.Y209C no/unknown
GARS 7 30655543 30655543 Missense_Mutation SNP G A p.V355I no/unknown
GBP2 1 89579880 89579880 Missense_Mutation SNP G A p.S323L no/unknown
GGA1 22 38028688 38028688 Silent SNP C T p.F630F no/unknown
GLMN 1 92732290 92732290 Silent SNP C A p.V369V no/unknown
GLTSCR1 19 48201960 48201960 Silent SNP C T p.S1106S no/unknown
GNA12 7 2883672 2883672 Missense_Mutation SNP C A p.D42Y no/unknown
GNB2L1 5 180666089 180666089 Missense_Mutation SNP G A p.S205F no/unknown
GNPDA2 4 44713011 44713011 Missense_Mutation SNP C A p.A185S no/unknown
GON4L 1 155783569 155783569 Missense_Mutation SNP G C p.I436M no/unknown
GOT2 16 58768050 58768050 Missense_Mutation SNP C G p.R28T no/unknown
GPATCH1 19 33616010 33616010 Splice_Site SNP G C no/unknown
GPC2 7 99769007 99769007 Missense_Mutation SNP C T p.E455K no/unknown
GPR112 0 135430276 135430276 Missense_Mutation SNP G T p.A1471S no/unknown
GPR123 10 134886465 134886465 Missense_Mutation SNP G A p.A167T no/unknown
GPR133 12 131487747 131487747 Silent SNP G C p.L348L no/unknown
GPR144 9 127230026 127230026 Silent SNP G A p.L658L no/unknown
GPRIN2 10 46999670 46999670 Missense_Mutation SNP T C p.S264P no/unknown
GRB10 7 50686981 50686981 Splice_Site SNP C T p.E221E no/unknown
GRIN3A 9 104385642 104385642 Missense_Mutation SNP C T p.D858N no/unknown
GRIN3A 9 104433216 104433216 Missense_Mutation SNP T A p.Y493F no/unknown
GSTM1 1 110231705 110231705 Silent SNP C T p.T71T no/unknown
GXYLT2 3 72957560 72957560 Silent SNP C T p.P106P no/unknown
HAUS8 19 17186213 17186213 Missense_Mutation SNP C G p.R7P no/unknown
HAX1 1 154246063 154246063 Missense_Mutation SNP C T p.S102F no/unknown
HDAC5 17 42169558 42169558 Silent SNP G T p.V338V no/unknown
HDX 0 83588820 83588820 Missense_Mutation SNP C T p.D591N no/unknown
HEATR2 7 801524 801524 Silent SNP G A p.L535L no/unknown
HEATR5B 2 37230827 37230827 Silent SNP C A p.L1636L no/unknown
HEATR5B 2 37302751 37302751 Missense_Mutation SNP C T p.M158I no/unknown
HELQ 4 84338014 84338014 Missense_Mutation SNP C T p.R1023Q no/unknown
HERC1 15 64045207 64045207 Missense_Mutation SNP T G p.K618Q no/unknown
HERC1 15 64048842 64048842 Nonsense_Mutation SNP G A p.Q443* no/unknown
HGSNAT 8 43016648 43016648 Silent SNP G A p.L215L no/unknown
HID1 17 72959145 72959145 Missense_Mutation SNP G A p.P140L no/unknown
HIRA 22 19338922 19338922 Missense_Mutation SNP C T p.V966I no/unknown
HIST1H1C 6 26056216 26056216 Silent SNP C G p.P147P no/unknown
HIVEP3 1 42048835 42048835 Missense_Mutation SNP G A p.S545F no/unknown
HLA-G 6 29795872 29795872 Missense_Mutation SNP G A p.R41H no/unknown
HMCN1 1 186143699 186143699 Missense_Mutation SNP G A p.E5290K no/unknown
HPS5 11 18327038 18327038 Missense_Mutation SNP G A p.S276L no/unknown
HYAL4 7 123517078 123517078 Nonsense_Mutation SNP C T p.Q439* no/unknown
IDNK 9 86258426 86258426 Missense_Mutation SNP G A p.D99N no/unknown
IGSF1 0 130409632 130409632 Missense_Mutation SNP G C p.L1002V no/unknown
IL18RAP 2 103040731 103040731 Missense_Mutation SNP G C p.E146Q no/unknown
INCA1 17 4892851 4892851 Missense_Mutation SNP C G p.W89C no/unknown
INSIG1 7 155090046 155090046 Silent SNP G A p.A17A no/unknown
INSRR 1 156815490 156815490 Missense_Mutation SNP G C p.L699V no/unknown
IQCA1 2 237396701 237396701 Missense_Mutation SNP G C p.S197C no/unknown
IQCD 12 113645745 113645745 Missense_Mutation SNP C G p.R76T no/unknown
IREB2 15 78765661 78765661 Missense_Mutation SNP G A p.E321K no/unknown
ISY1 3 128875488 128875488 Missense_Mutation SNP G C p.Q59E no/unknown
ITGA2 5 52367879 52367879 Splice_Site DEL G no/unknown
ITIH3 3 52840398 52840398 Missense_Mutation SNP C T p.R678C no/unknown
ITIH5 10 7621993 7621993 Silent SNP G A p.I381I no/unknown
ITSN1 21 35122447 35122447 Splice_Site SNP G C no/unknown
JMJD8 16 732965 732965 Missense_Mutation SNP G C p.I304M no/unknown
JMY 5 78587065 78587065 Silent SNP G A p.Q490Q no/unknown
JUND 19 18392184 18392184 Silent SNP C T p.P37P no/unknown
KALRN 3 124103848 124103848 Missense_Mutation SNP G A p.D641N no/unknown
KALRN 3 124437931 124437931 Silent SNP C T p.L1162L no/unknown
KANK1 9 740833 740833 Missense_Mutation SNP C A p.P1199T no/unknown
KBTBD12 3 127682150 127682150 Silent SNP C T p.L537L no/unknown
KCNA7 19 49573956 49573956 Silent SNP G A p.I245I no/unknown
KCNJ12 17 21319627 21319627 Missense_Mutation SNP C T p.H325Y no/unknown
KCNN1 19 18092786 18092786 Missense_Mutation SNP C G p.S256W no/unknown
KCNV1 8 110986244 110986244 Missense_Mutation SNP A C p.M125R no/unknown
KDM8 16 27231970 27231970 Missense_Mutation SNP G C p.E390D no/unknown
KIAA0319 6 24569119 24569119 Missense_Mutation SNP G T p.A677E no/unknown
KIAA0368 9 114137418 114137418 Missense_Mutation SNP C T p.R1362K no/unknown
KIAA0430 16 15702276 15702276 Missense_Mutation SNP C G p.D1352H no/unknown
KIAA1109 4 123132194 123132194 Missense_Mutation SNP C G p.P731A no/unknown
KIAA1211L 2 99449353 99449353 Missense_Mutation SNP T C p.N116S no/unknown
KIAA1549L 11 33667496 33667496 Missense_Mutation SNP C T p.P1595S no/unknown
KIAA2013 1 11982851 11982851 Missense_Mutation SNP G C p.L577V no/unknown
KIF14 1 200584665 200584665 Silent SNP C T p.T395T no/unknown
KIF26B 1 245530332 245530332 Missense_Mutation SNP C T p.P221L no/unknown
KIF9 3 47284724 47284724 Missense_Mutation SNP C A p.R509I no/unknown
KLC3 19 45853613 45853613 Silent SNP G A p.L386L no/unknown
KLF5 13 73649949 73649949 Missense_Mutation SNP C A p.F433L no/unknown
KLRF1 12 9980167 9980168 Frame_Shift_Ins INS T p.L10fs no/unknown
KNTC1 12 123100031 123100031 Silent SNP G A p.R1996R no/unknown
KPNA7 7 98792832 98792832 Silent SNP C A p.L138L no/unknown
KPNA7 7 98792849 98792849 Missense_Mutation SNP C G p.E133Q no/unknown
KPRP 1 152732617 152732617 Nonsense_Mutation SNP C T p.Q185* no/unknown
KRT23 17 39092693 39092693 Missense_Mutation SNP G T p.P55T no/unknown
KRT28 17 38955729 38955729 Silent SNP T C p.R139R no/unknown
KRT40 17 39140523 39140523 Start_Codon_SNP SNP C G p.M1I no/unknown
KRTAP1-3 17 39191033 39191033 Missense_Mutation SNP C G p.C14S no/unknown
KTI12 1 52499038 52499038 Silent SNP C T p.V132V no/unknown
LAMA1 18 6947194 6947194 Missense_Mutation SNP C T p.D2938N no/unknown
LAMA3 18 21399961 21399961 Splice_Site SNP G A p.Q768Q no/unknown
LAMA3 18 21487751 21487751 Missense_Mutation SNP G C p.K2289N no/unknown
LAMB4 7 107743639 107743639 Missense_Mutation SNP C G p.D344H no/unknown
LAP3 4 17579145 17579145 Silent SNP G A p.V19V no/unknown
LBX2 2 74725408 74725408 Missense_Mutation SNP G T p.F81L no/unknown
LCA5 6 80223105 80223105 Missense_Mutation SNP C G p.E182Q no/unknown
LDLR 19 11224259 11224259 Silent SNP C T p.I469I no/unknown
LIN9 1 226455660 226455660 Missense_Mutation SNP G A p.L288F no/unknown
LINC00998 7 112757507 112757507 Missense_Mutation SNP C G p.G43R no/unknown
LMO7 13 76432135 76432135 Missense_Mutation SNP C T p.H1382Y no/unknown
LPHN1 19 14263636 14263636 Missense_Mutation SNP G A p.S1133L no/unknown
LPHN3 4 62936447 62936447 Nonsense_Mutation SNP G T p.E1411* no/unknown
LRGUK 7 133812370 133812370 Nonsense_Mutation SNP G T p.E84* no/unknown
LRIG2 1 113653013 113653013 Missense_Mutation SNP G A p.V543M no/unknown
LRP1 12 57581175 57581175 Missense_Mutation SNP G A p.E2323K no/unknown
LRP5 11 68080214 68080215 In_Frame_Ins INS GCT p.20_21insL no/unknown
LRRC10 12 70004103 70004103 Missense_Mutation SNP G C p.I172M no/unknown
LRRC27 10 134188741 134188741 Missense_Mutation SNP C A p.Q530K no/unknown
LRRC8C 1 90178489 90178489 Silent SNP C G p.L120L no/unknown
MAB21L2 4 151504847 151504847 Missense_Mutation SNP G C p.Q222H no/unknown
MAML1 5 179193247 179193247 Silent SNP C G p.L412L no/unknown
MAP3K15 0 19378916 19378916 Missense_Mutation SNP G A p.S1298F no/unknown
MAPK8IP1 11 45926545 45926545 Missense_Mutation SNP C G p.F639L no/unknown
MAPKBP1 15 42109619 42109619 Missense_Mutation SNP G C p.G588A no/unknown
MARCH10 17 60813887 60813887 Missense_Mutation SNP G C p.Q448E no/unknown
MARCH5 10 94100459 94100459 Missense_Mutation SNP G C p.D90H no/unknown
MARCH5 10 94100554 94100554 Silent SNP G A p.V121V no/unknown
MARK2 11 63668108 63668108 Silent SNP G A p.K249K no/unknown
MAST4 5 66461160 66461160 Silent SNP G A p.A2051A no/unknown
MASTL 10 27459831 27459831 Missense_Mutation SNP C T p.S648F no/unknown
MAT1A 10 82039931 82039931 Nonsense_Mutation SNP G A p.Q183* no/unknown
MDC1 6 30680215 30680215 Missense_Mutation SNP C T p.D502N no/unknown
MECR 1 29543098 29543098 Splice_Site SNP A T no/unknown
MED12L 3 150881691 150881691 Silent SNP C T p.L373L no/unknown
MED23 6 131923480 131923480 Missense_Mutation SNP C T p.S658N no/unknown
MED25 19 50322461 50322461 Silent SNP C T p.F71F no/unknown
MEF2B 19 19257429 19257429 Missense_Mutation SNP G A p.P235L no/unknown
MEGF6 1 3413639 3413639 Nonsense_Mutation SNP G A p.Q1176* no/unknown
MEIS3 19 47912435 47912435 Missense_Mutation SNP C G p.R260P no/unknown
MLLT4 6 168323622 168323622 Missense_Mutation SNP C T p.R992C no/unknown
MMEL1 1 2522483 2522483 Silent SNP G A p.F762F no/unknown
MPRIP 17 17062290 17062290 Missense_Mutation SNP G A p.E674K no/unknown
MR1 1 181018229 181018229 Missense_Mutation SNP C T p.P37S no/unknown
MRPS22 3 139067062 139067062 Missense_Mutation SNP G A p.E134K no/unknown
MRPS26 20 3026854 3026854 Missense_Mutation SNP C A p.A47E no/unknown
MT-CO1 0 6776 6776 Silent SNP T C p.H291H no/unknown
MT-ND5 0 12756 12756 Silent SNP G A p.L140L no/unknown
MTRF1 13 41834987 41834987 Silent SNP G A p.L19L no/unknown
MUC12 7 100655709 100655709 Silent SNP T G p.L5271L no/unknown
MUC3A 7 100551883 100551883 Missense_Mutation SNP A G p.T212A no/unknown
MURC 9 103348388 103348388 Silent SNP G A p.Q250Q no/unknown
MXRA5 0 3239455 3239455 Missense_Mutation SNP G C p.S1424C no/unknown
MYBPC2 19 50961893 50961893 Silent SNP C T p.F796F no/unknown
MYBPC2 19 50964861 50964861 Silent SNP G T p.V998V no/unknown
MYCBP2 13 77641878 77641878 Missense_Mutation SNP C G p.G4060A no/unknown
MYH15 3 108218980 108218980 Nonsense_Mutation SNP G A p.Q181* no/unknown
MYH6 14 23865593 23865593 Missense_Mutation SNP C T p.E777K no/unknown
MYH7 14 23893266 23893266 Missense_Mutation SNP C G p.E924D no/unknown
MYOM3 1 24406673 24406673 Missense_Mutation SNP C T p.D807N no/unknown
MYT1 20 62848597 62848597 Missense_Mutation SNP G T p.K603N no/unknown
NAA15 4 140270670 140270670 Missense_Mutation SNP G A p.G249E no/unknown
NAGLU 17 40695680 40695680 Silent SNP C T p.T552T no/unknown
NBEAL1 2 203995131 203995131 Missense_Mutation SNP G T p.A1137S no/unknown
NBPF6 1 109010281 109010281 Silent SNP T C p.S623S no/unknown
NCAM2 21 22658708 22658708 Missense_Mutation SNP G A p.E153K no/unknown
NDC1 1 54293800 54293800 Silent SNP G A p.I109I no/unknown
NEK7 1 198262137 198262137 Missense_Mutation SNP G A p.D218N no/unknown
NELFCD 20 57561148 57561148 Splice_Site SNP C T p.Q30* no/unknown
NFIC 19 3435149 3435149 Missense_Mutation SNP C G p.T301S no/unknown
NFIC 19 3435093 3435093 Silent SNP C T p.H282H no/unknown
NID1 1 236143160 236143160 Silent SNP C T p.T1157T no/unknown
NID1 1 236189236 236189236 Silent SNP G A p.I648I no/unknown
NLRP13 19 56422023 56422023 Missense_Mutation SNP C T p.E730K no/unknown
NOC2L 1 887472 887472 Missense_Mutation SNP G C p.F413L no/unknown
NOVA1 14 27064733 27064733 Missense_Mutation SNP G A p.L55F no/unknown
NR3C1 5 142779895 142779895 Silent SNP C T p.L170L no/unknown
NRCAM 7 107849962 107849962 Silent SNP C T p.Q326Q no/unknown
NSUN6 10 18840898 18840898 Missense_Mutation SNP C T p.E309K no/unknown
NUDT17 1 145587431 145587431 Missense_Mutation SNP C G p.D217H no/unknown
NUP210 3 13417137 13417137 Missense_Mutation SNP C T p.G433E no/unknown
NUP210L 1 154076626 154076626 Missense_Mutation SNP C T p.G561S no/unknown
NUP43 6 150067151 150067151 Missense_Mutation SNP G C p.D56E no/unknown
NUP88 17 5319890 5319890 Missense_Mutation SNP G A p.P137L no/unknown
OBSCN 1 228468368 228468368 Missense_Mutation SNP G A p.D2690N no/unknown
OBSCN 1 228504634 228504634 Missense_Mutation SNP G A p.V4504I no/unknown
OGFR 20 61444840 61444840 Missense_Mutation SNP C A p.R625S no/unknown
OMA1 1 58946781 58946781 Silent SNP G A p.F477F no/unknown
OMA1 1 59004507 59004507 Missense_Mutation SNP G C p.L154V no/unknown
OR10H2 19 15839732 15839732 Silent SNP C T p.L293L no/unknown
OR13H1 0 130678141 130678141 Silent SNP C T p.L32L no/unknown
OR14I1 1 248845358 248845358 Missense_Mutation SNP G A p.S83F no/unknown
OR1A2 17 3101712 3101712 Missense_Mutation SNP G T p.Q300H no/unknown
OR2G6 1 248685298 248685298 Silent SNP C T p.V117V no/unknown
OR52I2 11 4608365 4608365 Missense_Mutation SNP T A p.V108E no/unknown
OR52K1 11 4511034 4511034 Missense_Mutation SNP C T p.R302C no/unknown
OR52N1 11 5809393 5809393 Silent SNP G A p.I218I no/unknown
OR5F1 11 55761436 55761436 Silent SNP G A p.L222L no/unknown
OR5K2 3 98217133 98217133 Silent SNP A C p.S203S no/unknown
OR5K3 3 98110308 98110308 Missense_Mutation SNP G A p.D267N no/unknown
OR9I1 11 57886843 57886843 Missense_Mutation SNP A G p.I25T no/unknown
OTOP2 17 72927245 72927245 Silent SNP C A p.V505V no/unknown
OXNAD1 3 16343347 16343348 Frame_Shift_Ins INS A p.AK216fs no/unknown
PADI4 1 17685332 17685332 Splice_Site SNP G C no/unknown
PAK4 19 39660244 39660244 Silent SNP C T p.F17F no/unknown
PAK7 20 9538330 9538330 Silent SNP G A p.L556L no/unknown
PALD1 10 72289663 72289663 Missense_Mutation SNP C T p.R103W no/unknown
PAPPA 9 119093597 119093597 Silent SNP C T p.Y1074Y no/unknown
PAQR7 1 26190241 26190241 Silent SNP G C p.V30V no/unknown
PAQR7 1 26190320 26190320 Missense_Mutation SNP G T p.A4D no/unknown
PARP14 3 122437541 122437541 Missense_Mutation SNP A T p.I1515F no/unknown
PBXIP1 1 154917558 154917558 Missense_Mutation SNP C G p.R713T no/unknown
PCDH11X 0 91133904 91133904 Missense_Mutation SNP G A p.E889K no/unknown
PCDHA13 5 140263778 140263778 Missense_Mutation SNP C T p.A642V no/unknown
PCDHA8 5 140222611 140222611 Missense_Mutation SNP C T p.R569W no/unknown
PCDHGA11 5 140801036 140801036 Missense_Mutation SNP G T p.R81L no/unknown
PCDHGA4 5 140736380 140736380 Missense_Mutation SNP G A p.G538E no/unknown
PCDHGA5 5 140744221 140744221 Missense_Mutation SNP C G p.I108M no/unknown
PCLO 7 82457194 82457194 Missense_Mutation SNP C T p.E4780K no/unknown
PCSK5 9 78973711 78973711 Missense_Mutation SNP A G p.D1819G no/unknown
PDE11A 2 178545604 178545604 Silent SNP G A p.V791V no/unknown
PDE1C 7 31904609 31904609 Missense_Mutation SNP C T p.A233T no/unknown
PDE8A 15 85659344 85659344 Missense_Mutation SNP A G p.H510R no/unknown
PDP1 8 94935198 94935198 Nonsense_Mutation SNP C G p.S304* no/unknown
PDZD2 5 32089152 32089152 Silent SNP G A p.K1866K no/unknown
PDZRN3 3 73651582 73651582 Missense_Mutation SNP T G p.I281L no/unknown
PEG3 19 57327402 57327402 Missense_Mutation SNP G A p.A803V no/unknown
PFDN4 20 52835604 52835604 Nonsense_Mutation SNP C G p.S107* no/unknown
PFKFB3 10 6258109 6258109 Silent SNP G A p.L107L no/unknown
PGK1 0 77380433 77380433 Missense_Mutation SNP G C p.Q333H no/unknown
PHF16 0 46898446 46898446 Silent SNP G A p.L317L no/unknown
PHLPP1 18 60642791 60642791 Missense_Mutation SNP G C p.R1306T no/unknown
PHOSPHO2 2 170558169 170558169 Missense_Mutation SNP G A p.D230N no/unknown
PHRF1 11 597425 597425 Missense_Mutation SNP C T p.S250F no/unknown
PIK3R4 3 130398176 130398176 Missense_Mutation SNP C T p.V1354M no/unknown
PILRA 7 99987710 99987710 Silent SNP C G p.L218L no/unknown
PINK1 1 20972199 20972199 Missense_Mutation SNP T C p.L369P no/unknown
PKD1L1 7 47842863 47842863 Missense_Mutation SNP A G p.M2636T no/unknown
PLA1A 3 119325712 119325712 Silent SNP C G p.L55L no/unknown
PLA1A 3 119325774 119325774 Missense_Mutation SNP C G p.S76C no/unknown
PLA2G16 11 63365573 63365573 Silent SNP G A p.I26I no/unknown
PLA2G4A 1 186839570 186839570 Missense_Mutation SNP G A p.E13K no/unknown
PLA2G4B 15 42134119 42134119 Nonsense_Mutation SNP G A p.W198* no/unknown
PLEKHG5 1 6536011 6536011 Missense_Mutation SNP C G p.E99D no/unknown
PMPCA 9 139310781 139310781 Missense_Mutation SNP G C p.E191Q no/unknown
PNKD 2 219206807 219206807 Nonsense_Mutation SNP G T p.E241* no/unknown
PNMA3 0 152226745 152226745 Missense_Mutation SNP G A p.E445K no/unknown
POU3F4 0 82763851 82763851 Silent SNP C G p.G173G no/unknown
PPEF1 0 18768058 18768058 Silent SNP C T p.F128F no/unknown
PPFIBP2 11 7586867 7586867 Missense_Mutation SNP G A p.V50M no/unknown
PPL 16 4934086 4934086 Missense_Mutation SNP C T p.E1524K no/unknown
PPP5D1 19 47029011 47029011 Missense_Mutation SNP A G p.L89P no/unknown
PRDM15 21 43287438 43287438 Missense_Mutation SNP G C p.P197R no/unknown
PRDM5 4 121737654 121737654 Silent SNP C T p.L273L no/unknown
PRIMPOL 4 185593429 185593429 Nonsense_Mutation SNP C G p.S220* no/unknown
PROX1 1 214184866 214184866 Silent SNP C T p.F612F no/unknown
PROX2 14 75329431 75329431 Silent SNP G A p.S369S no/unknown
PRPF40A 2 153515613 153515613 Missense_Mutation SNP C T p.E834K no/unknown
PRRC2C 1 171492400 171492400 Missense_Mutation SNP G C p.E290Q no/unknown
PRRG3 0 150868611 150868611 Missense_Mutation SNP G A p.E51K no/unknown
PRSS37 7 141537907 141537907 Silent SNP C T p.L61L no/unknown
PRTFDC1 10 25140320 25140320 Silent SNP C T p.L209L no/unknown
PSME4 2 54153154 54153154 Silent SNP G T p.R534R no/unknown
PTBP2 1 97250705 97250705 Missense_Mutation SNP G A p.D267N no/unknown
PTCD3 2 86343693 86343693 Missense_Mutation SNP A G p.Y94C no/unknown
PTGER4 5 40681692 40681692 Silent SNP C T p.T199T no/unknown
PTGS2 1 186645290 186645290 Missense_Mutation SNP C T p.D333N no/unknown
PTPLA 10 17632416 17632416 Missense_Mutation SNP G A p.R272C no/unknown
PUM2 2 20490479 20490480 Frame_Shift_Del DEL GT p.L409fs no/unknown
PXK 3 58368270 58368271 Frame_Shift_Ins INS A p.K78fs no/unknown
PYGL 14 51379792 51379792 Silent SNP G A p.F525F no/unknown
PZP 12 9349613 9349613 Nonsense_Mutation SNP G A p.Q288* no/unknown
RAB11FIP3 16 532582 532582 Missense_Mutation SNP G A p.E321K no/unknown
RAB6C 2 130737822 130737822 Missense_Mutation SNP T C p.I45T no/unknown
RAB7A 3 128514231 128514231 Silent SNP G A p.V7V no/unknown
RAD50 5 131976457 131976457 Missense_Mutation SNP G A p.D1238N no/unknown
RADIL 7 4874374 4874374 Missense_Mutation SNP G A p.P427L no/unknown
RALGAPA1 14 36041872 36041872 Missense_Mutation SNP C G p.R1915T no/unknown
RBMX2 0 129536257 129536257 Missense_Mutation SNP G A p.E12K no/unknown
RBMXL2 11 7111285 7111285 Missense_Mutation SNP C T p.R312W no/unknown
RC3H2 9 125622256 125622256 Missense_Mutation SNP G T p.Q597K no/unknown
RC3H2 9 125622257 125622257 Silent SNP A T p.I596I no/unknown
RC3H2 9 125622267 125622267 Missense_Mutation SNP G A p.S593F no/unknown
RCC2 1 17764893 17764893 Missense_Mutation SNP C T p.E40K no/unknown
RDH10 8 74233236 74233236 Missense_Mutation SNP G A p.E232K no/unknown
RETN 19 7734758 7734758 Missense_Mutation SNP G A p.R57K no/unknown
REV1 2 100020228 100020228 Silent SNP C T p.L1032L no/unknown
RGL1 1 183895291 183895291 Silent SNP G A p.V724V no/unknown
RIMS4 20 43386371 43386371 Missense_Mutation SNP C T p.E131K no/unknown
RLF 1 40704350 40704350 Missense_Mutation SNP G A p.G1326S no/unknown
RMDN3 15 41029920 41029920 Missense_Mutation SNP G C p.S377C no/unknown
RNASEH2B 13 51530586 51530587 Frame_Shift_Ins INS A p.K306fs no/unknown
RNF113A 0 119005520 119005520 Silent SNP G A p.F19F no/unknown
RNF17 13 25370396 25370396 Missense_Mutation SNP G C p.R454S no/unknown
RNPEP 1 201974763 201974763 Silent SNP G A p.E624E no/unknown
RNPEPL1 2 241516264 241516264 Splice_Site SNP G C no/unknown
RNPEPL1 2 241513267 241513267 Silent SNP G C p.L68L no/unknown
ROBO3 11 124739846 124739846 Silent SNP C T p.I216I no/unknown
ROR1 1 64606036 64606036 Silent SNP C T p.L285L no/unknown
ROR2 9 94487198 94487198 Missense_Mutation SNP C A p.M526I no/unknown
RPRD1B 20 36662501 36662507 Splice_Site DEL GTAAACA no/unknown
RPS25 11 118888132 118888132 Missense_Mutation SNP C G p.E75Q no/unknown
RPS6KA3 0 20193362 20193362 Missense_Mutation SNP G A p.R383W no/unknown
RPS6KB2 11 67200882 67200882 Silent SNP C T p.P290P no/unknown
RRM2 2 10263543 10263543 Missense_Mutation SNP G C p.E68D no/unknown
RRP12 10 99139130 99139130 Missense_Mutation SNP A G p.I573T no/unknown
RTN4 2 55277143 55277143 Silent SNP G C p.P98P no/unknown
RYR2 1 237819187 237819187 Missense_Mutation SNP C T p.P2678S no/unknown
SALL3 18 76754013 76754013 Missense_Mutation SNP G T p.K674N no/unknown
SAMSN1 21 15884891 15884891 Missense_Mutation SNP C G p.E95Q no/unknown
SARM1 17 26708508 26708508 Missense_Mutation SNP T C p.W219R no/unknown
SASH1 6 148865736 148865736 Missense_Mutation SNP C T p.L1044F no/unknown
SCARA3 8 27516721 27516721 Missense_Mutation SNP C G p.S345C no/unknown
SCARA3 8 27516836 27516836 Silent SNP C G p.L383L no/unknown
SCARB1 12 125296479 125296479 Silent SNP C T p.V221V no/unknown
SCIN 7 12683880 12683880 Missense_Mutation SNP G C p.E567Q no/unknown
SCN11A 3 38889129 38889129 Missense_Mutation SNP G A p.R1478W no/unknown
SDK1 7 4026889 4026889 Missense_Mutation SNP C T p.S689F no/unknown
SECISBP2L 15 49292128 49292128 Missense_Mutation SNP G T p.P769T no/unknown
SECISBP2L 15 49309825 49309825 Splice_Site SNP C T p.D391N no/unknown
SELE 1 169698511 169698511 Silent SNP C T p.V302V no/unknown
SEMA3F 3 50211681 50211681 Silent SNP C T p.F118F no/unknown
SEMA4C 2 97526370 97526370 Nonsense_Mutation SNP G T p.S832* no/unknown
SEMA6C 1 151108989 151108989 Silent SNP G A p.F347F no/unknown
SEPT14 7 55914248 55914248 Missense_Mutation SNP G C p.S46C no/unknown
SERPINA7 0 105279275 105279275 Missense_Mutation SNP C T p.E242K no/unknown
SERPINF2 17 1650382 1650382 Missense_Mutation SNP A T p.H146L no/unknown
SERTAD2 2 64863402 64863402 Missense_Mutation SNP C T p.E202K no/unknown
SFI1 22 32007754 32007754 Silent SNP C G p.L806L no/unknown
SGOL2 2 201407371 201407371 Missense_Mutation SNP C T p.R153C no/unknown
SH2D3C 9 130536715 130536715 Silent SNP G C p.L23L no/unknown
SIAH2 3 150460112 150460112 Missense_Mutation SNP C G p.R264T no/unknown
SIN3A 15 75693190 75693190 Missense_Mutation SNP C T p.E540K no/unknown
SIX4 14 61190185 61190185 Missense_Mutation SNP C G p.G203A no/unknown
SLC11A2 12 51398623 51398623 Missense_Mutation SNP C G p.G126A no/unknown
SLC14A2 18 43206962 43206962 Missense_Mutation SNP G A p.R124K no/unknown
SLC1A4 2 65217194 65217194 Missense_Mutation SNP C G p.I139M no/unknown
SLC22A6 11 62749325 62749325 Silent SNP G A p.F262F no/unknown
SLC24A5 15 48429046 48429046 Missense_Mutation SNP G A p.E253K no/unknown
SLC24A5 15 48429009 48429009 Silent SNP G A p.E240E no/unknown
SLC25A34 1 16065098 16065098 Missense_Mutation SNP G C p.E203Q no/unknown
SLC32A1 20 37356322 37356322 Silent SNP G A p.V206V no/unknown
SLC6A12 12 307137 307137 Missense_Mutation SNP G C p.F293L no/unknown
SLC6A15 12 85285728 85285728 Missense_Mutation SNP C T p.E58K no/unknown
SLC9A3 5 475105 475105 Silent SNP G A p.F798F no/unknown
SLFN11 17 33679519 33679519 Silent SNP A G p.V854V no/unknown
SMARCA2 9 2039575 2039575 Silent SNP C T p.A155A no/unknown
SMARCA2 9 2077644 2077644 Silent SNP C T p.D684D no/unknown
SMARCC1 3 47719693 47719693 Silent SNP C T p.V522V no/unknown
SMARCC1 3 47814322 47814322 Silent SNP G A p.A100A no/unknown
SMARCC2 12 56583231 56583231 Silent SNP C T p.K5K no/unknown
SMUG1 12 54576264 54576264 Silent SNP G T p.G143G no/unknown
SMUG1 12 54576265 54576265 Missense_Mutation SNP C A p.G143V no/unknown
SNAP25 20 10258334 10258334 Splice_Site SNP C T p.S25L no/unknown
SNTG1 8 51617238 51617238 Missense_Mutation SNP G A p.E373K no/unknown
SOD1 21 33032109 33032109 Silent SNP G A p.L9L no/unknown
SOGA2 18 8783924 8783924 Missense_Mutation SNP A G p.T632A no/unknown
SOWAHC 2 110372616 110372616 Missense_Mutation SNP G A p.E184K no/unknown
SOX17 8 55372292 55372292 Missense_Mutation SNP C T p.P328S no/unknown
SOX17 8 55372293 55372293 Missense_Mutation SNP C T p.P328L no/unknown
SOX5 12 23999058 23999058 Missense_Mutation SNP C T p.E114K no/unknown
SPATS2 12 49890648 49890648 Missense_Mutation SNP G A p.E187K no/unknown
SPRY3 0 155003555 155003555 Missense_Mutation SNP G C p.D8H no/unknown
SQLE 8 126015583 126015583 Missense_Mutation SNP G C p.E153Q no/unknown
SREBF2 22 42289195 42289195 Silent SNP C G p.L761L no/unknown
SRPK3 0 153049772 153049772 Silent SNP C T p.L391L no/unknown
SRRM2 16 2807899 2807899 Silent SNP T C p.R156R no/unknown
SRRM2 16 2817476 2817476 Missense_Mutation SNP C T p.T2316I no/unknown
SRSF6 20 42088733 42088733 Nonsense_Mutation SNP G T p.E148* no/unknown
SRSF6 20 42089696 42089696 Missense_Mutation SNP G C p.R343T no/unknown
SRSF7 2 38976798 38976798 Missense_Mutation SNP G C p.R87G no/unknown
SSH1 12 109201582 109201582 Missense_Mutation SNP G C p.H186Q no/unknown
STON1 2 48808446 48808446 Missense_Mutation SNP C T p.S225L no/unknown
STT3A 11 125479479 125479479 Missense_Mutation SNP T G p.F371C no/unknown
SULT2B1 19 49079253 49079253 Silent SNP C T p.L43L no/unknown
SVIL 10 29747448 29747448 Missense_Mutation SNP G A p.P2158L no/unknown
SVIL 10 29801731 29801731 Missense_Mutation SNP T G p.Q1150P no/unknown
SYCP1 1 115537600 115537601 Frame_Shift_Ins INS A p.RK964fs no/unknown
SYMPK 19 46319244 46319244 Silent SNP C G p.P1184P no/unknown
SYMPK 19 46338443 46338443 Missense_Mutation SNP G A p.S429F no/unknown
SYNE1 6 152615230 152615230 Missense_Mutation SNP C G p.E5905D no/unknown
SYNE1 6 152720788 152720788 Missense_Mutation SNP C A p.Q2400H no/unknown
SYNE1 6 152771804 152771804 Silent SNP C T p.R1117R no/unknown
SYNRG 17 35936456 35936456 Missense_Mutation SNP T C p.N295S no/unknown
SYT11 1 155850307 155850307 Missense_Mutation SNP G A p.G293E no/unknown
SYT11 1 155851287 155851287 Silent SNP G C p.L428L no/unknown
SZT2 1 43905289 43905289 Silent SNP C T p.I2240I no/unknown
TACC2 10 123987362 123987362 Missense_Mutation SNP G C p.E2579Q no/unknown
TAF13 1 109617639 109617639 Missense_Mutation SNP C T p.G26S no/unknown
TAF2 8 120758976 120758976 Missense_Mutation SNP C A p.S1026I no/unknown
TAF3 10 8007106 8007106 Nonsense_Mutation SNP G T p.E545* no/unknown
TBC1D30 12 65237185 65237185 Missense_Mutation SNP G C p.D483H no/unknown
TCHHL1 1 152060605 152060605 Silent SNP C G p.L5L no/unknown
TDRD6 6 46660511 46660511 Missense_Mutation SNP T A p.V1549E no/unknown
TDRKH 1 151748592 151748592 Silent SNP C A p.L399L no/unknown
TENC1 12 53453101 53453101 Missense_Mutation SNP G A p.R559H no/unknown
TENM1 0 123637539 123637539 Missense_Mutation SNP C G p.E1106Q no/unknown
TET3 2 74307693 74307693 Missense_Mutation SNP C G p.S750C no/unknown
THBS4 5 79351696 79351696 Silent SNP C T p.I127I no/unknown
THOP1 19 2790525 2790525 Silent SNP C T p.I41I no/unknown
THOP1 19 2790597 2790597 Silent SNP C G p.L65L no/unknown
TIMM8B 11 111957426 111957426 Missense_Mutation SNP C A p.D8Y no/unknown
TIPARP 3 156395809 156395809 Missense_Mutation SNP C T p.S108F no/unknown
TLCD2 17 1613437 1613437 Silent SNP G T p.R34R no/unknown
TMCC2 1 205238095 205238095 Silent SNP G C p.L255L no/unknown
TMCC2 1 205238159 205238159 Missense_Mutation SNP G A p.D277N no/unknown
TMCO2 1 40717193 40717193 Missense_Mutation SNP C T p.S159F no/unknown
TMEFF1 9 103334910 103334910 Missense_Mutation SNP G A p.G337E no/unknown
TMEM132A 11 60704361 60704361 Silent SNP G A p.R1018R no/unknown
TMEM219 16 29982829 29982829 Missense_Mutation SNP C T p.P229L no/unknown
TMEM246 9 104238225 104238225 Missense_Mutation SNP G T p.L384I no/unknown
TMF1 3 69096873 69096873 Missense_Mutation SNP G A p.S328L no/unknown
TNFAIP8L2 1 151131669 151131669 Nonsense_Mutation SNP C T p.Q166* no/unknown
TNR 1 175375425 175375425 Silent SNP C T p.E142E no/unknown
TOP1MT 8 144403506 144403506 Silent SNP G A p.T337T no/unknown
TOP2A 17 38546338 38546338 Missense_Mutation SNP G C p.S1449C no/unknown
TOPAZ1 3 44286192 44286192 Missense_Mutation SNP A G p.K732E no/unknown
TOR1AIP1 1 179886985 179886985 Missense_Mutation SNP G T p.D455Y no/unknown
TRAF3IP3 1 209935909 209935909 Nonsense_Mutation SNP C G p.S132* no/unknown
TRIM22 11 5730285 5730285 Missense_Mutation SNP G C p.D302H no/unknown
TRIM42 3 140407128 140407128 Missense_Mutation SNP G A p.R535Q no/unknown
TRIM6 11 5624789 5624789 Missense_Mutation SNP G A p.E83K no/unknown
TRIM69 15 45059907 45059907 Silent SNP C T p.F480F no/unknown
TRIP12 2 230668398 230668398 Missense_Mutation SNP C T p.A888T no/unknown
TRMT11 6 126342306 126342308 Splice_Site DEL ATA p.380_381EY>D no/unknown
TRMT1L 1 185114593 185114593 Silent SNP C T p.E211E no/unknown
TRMT2B 0 100292016 100292016 Missense_Mutation SNP C T p.R162Q no/unknown
TRMT2B 0 100297149 100297149 Missense_Mutation SNP G C p.L44V no/unknown
TRMT61B 2 29075344 29075344 Missense_Mutation SNP G A p.P339S no/unknown
TRPM8 2 234862576 234862576 Missense_Mutation SNP G A p.E386K no/unknown
TSC22D4 7 100075126 100075126 Missense_Mutation SNP G C p.A179G no/unknown
TSEN2 3 12545185 12545185 Missense_Mutation SNP C T p.L245F no/unknown
TSGA13 7 130353917 130353917 Missense_Mutation SNP C G p.E255D no/unknown
TSHZ3 19 31768064 31768064 Silent SNP G A p.L879L no/unknown
TSHZ3 19 31769463 31769463 Silent SNP G T p.I412I no/unknown
TSPYL4 6 116574953 116574953 Silent SNP G T p.L73L no/unknown
TTC1 5 159437625 159437625 Silent SNP C T p.G30G no/unknown
TTF1 9 135261977 135261977 Missense_Mutation SNP C T p.E782K no/unknown
TTLL6 17 46882240 46882240 Missense_Mutation SNP C T p.D73N no/unknown
TTN 2 179443742 179443742 Missense_Mutation SNP C T p.G21031E no/unknown
TTN 2 179462372 179462372 Missense_Mutation SNP G A p.S17505L no/unknown
TTN 2 179485676 179485676 Missense_Mutation SNP C G p.E13580Q no/unknown
TTN 2 179516229 179516229 Missense_Mutation SNP C G p.K11659N no/unknown
TTN 2 179542453 179542453 Missense_Mutation SNP C T p.E11079K no/unknown
TUBGCP4 15 43690268 43690268 Missense_Mutation SNP C T p.R438W no/unknown
TULP1 6 35473867 35473867 Silent SNP C T p.T304T no/unknown
TULP4 6 158902096 158902096 Missense_Mutation SNP C A p.P421T no/unknown
TUSC1 9 25678240 25678240 Missense_Mutation SNP C A p.R27L no/unknown
UBAP2L 1 154207102 154207102 Silent SNP C G p.V105V no/unknown
UBC 12 125396438 125396438 Missense_Mutation SNP G T p.P247H no/unknown
UBE3A 15 25601192 25601192 Missense_Mutation SNP C G p.Q660H no/unknown
UBFD1 16 23569385 23569385 Missense_Mutation SNP C G p.S47C no/unknown
UBQLN1 9 86297907 86297907 Missense_Mutation SNP T C p.N136S no/unknown
UBR1 15 43317141 43317141 Silent SNP G A p.F875F no/unknown
UFC1 1 161123821 161123821 Missense_Mutation SNP G C p.E12Q no/unknown
UGCG 9 114691932 114691932 Nonsense_Mutation SNP C A p.Y237* no/unknown
UGT2B10 4 69696592 69696592 Missense_Mutation SNP G A p.D528N no/unknown
UNC13A 19 17738738 17738738 Silent SNP G A p.L1255L no/unknown
UPF1 19 18976961 18976961 Missense_Mutation SNP T G p.S1127A no/unknown
USH2A 1 216062321 216062321 Missense_Mutation SNP C T p.R2557K no/unknown
USHBP1 19 17367430 17367430 Missense_Mutation SNP C G p.K440N no/unknown
USP11 0 47100031 47100031 Missense_Mutation SNP G A p.A286T no/unknown
USP24 1 55604684 55604684 Splice_Site SNP C G no/unknown
USP28 11 113679905 113679905 Nonsense_Mutation SNP G A p.Q682* no/unknown
USP32 17 58286852 58286852 Missense_Mutation SNP G C p.S826C no/unknown
USP41 22 20731461 20731461 Missense_Mutation SNP C T p.A80T no/unknown
USP9X 0 41029371 41029371 Silent SNP C G p.L920L no/unknown
USPL1 13 31231730 31231730 Missense_Mutation SNP G C p.D506H no/unknown
VASH1 14 77242515 77242515 Missense_Mutation SNP G C p.E271Q no/unknown
VGF 7 100806705 100806705 Missense_Mutation SNP C G p.E474Q no/unknown
VGLL4 3 11606376 11606376 Silent SNP G T p.L65L no/unknown
VWA1 1 1372432 1372432 Missense_Mutation SNP G A p.G67S no/unknown
WDFY3 4 85678089 85678089 Missense_Mutation SNP T C p.Q1805R no/unknown
WDR64 1 241850796 241850796 Missense_Mutation SNP G A p.M281I no/unknown
WDR65 1 43650998 43650998 Missense_Mutation SNP G C p.D314H no/unknown
WDR66 12 122396962 122396962 Missense_Mutation SNP A G p.I699V no/unknown
WDR90 16 703581 703581 Missense_Mutation SNP G C p.R430S no/unknown
WNK1 12 863394 863394 Silent SNP C G p.L221L no/unknown
WNT2 7 116955158 116955158 Silent SNP C T p.L185L no/unknown
WNT2B 1 113033683 113033683 Silent SNP G A p.A35A no/unknown
WNT9A 1 228135526 228135526 Silent SNP G A p.L21L no/unknown
WSB2 12 118473111 118473111 Silent SNP G A p.P284P no/unknown
WSB2 12 118490228 118490228 Missense_Mutation SNP C G p.W23C no/unknown
WSCD2 12 108620901 108620901 Silent SNP G A p.G313G no/unknown
XIRP2 2 168108159 168108159 Missense_Mutation SNP C G p.F3419L no/unknown
XK 0 37587536 37587536 Missense_Mutation SNP G A p.E386K no/unknown
XYLT1 16 17353179 17353179 Missense_Mutation SNP C G p.L193F no/unknown
XYLT1 16 17353209 17353209 Missense_Mutation SNP C G p.K183N no/unknown
ZBTB33 0 119388414 119388414 Nonsense_Mutation SNP C T p.Q382* no/unknown
ZBTB7C 18 45567056 45567057 In_Frame_Ins INS TCA p.141_141D>DD no/unknown
ZC3H12C 11 110030160 110030160 Missense_Mutation SNP G A p.E365K no/unknown
ZCRB1 12 42717842 42717842 Silent SNP C T p.L21L no/unknown
ZIC2 13 100634369 100634369 Missense_Mutation SNP C G p.F17L no/unknown
ZIC4 3 147113706 147113706 Silent SNP A G p.P207P no/unknown
ZIC4 3 147113712 147113712 Silent SNP A G p.P205P no/unknown
ZKSCAN1 7 99631139 99631140 Frame_Shift_Ins INS A p.K338fs no/unknown
ZNF106 15 42743260 42743260 Missense_Mutation SNP C G p.D381H no/unknown
ZNF12 7 6731355 6731355 Silent SNP C T p.V406V no/unknown
ZNF12 7 6731530 6731530 Nonsense_Mutation SNP G C p.S348* no/unknown
ZNF141 4 367457 367458 Frame_Shift_Ins INS AC p.S411fs no/unknown
ZNF141 4 367459 367460 Frame_Shift_Del DEL TC p.SQ411fs no/unknown
ZNF213 16 3191255 3191255 Silent SNP C T p.F429F no/unknown
ZNF217 20 52192874 52192874 Missense_Mutation SNP G C p.S810C no/unknown
ZNF318 6 43324931 43324931 Missense_Mutation SNP G A p.S374F no/unknown
ZNF335 20 44596525 44596525 Missense_Mutation SNP G A p.P221L no/unknown
ZNF346 5 176491573 176491573 Silent SNP G A p.Q286Q no/unknown
ZNF385D 3 21465486 21465486 Missense_Mutation SNP T G p.N308T no/unknown
ZNF398 7 148876739 148876739 Missense_Mutation SNP G C p.G592A no/unknown
ZNF415 19 53612089 53612089 Missense_Mutation SNP C G p.W403C no/unknown
ZNF443 19 12542643 12542643 Missense_Mutation SNP G A p.H115Y no/unknown
ZNF490 19 12692196 12692196 Silent SNP G A p.F231F no/unknown
ZNF518B 4 10444776 10444776 Missense_Mutation SNP C G p.L1059F no/unknown
ZNF541 19 48035410 48035410 Missense_Mutation SNP C T p.M1092I no/unknown
ZNF546 19 40521262 40521262 Silent SNP T C p.C695C no/unknown
ZNF557 19 7081421 7081421 Missense_Mutation SNP A G p.K93E no/unknown
ZNF568 19 37441058 37441058 Missense_Mutation SNP G A p.E335K no/unknown
ZNF568 19 37441495 37441495 Silent SNP G A p.G480G no/unknown
ZNF616 19 52618187 52618188 Frame_Shift_Ins INS T p.P744fs no/unknown
ZNF622 5 16465329 16465329 Missense_Mutation SNP G A p.P149L no/unknown
ZNF627 19 11728454 11728454 Missense_Mutation SNP G A p.R379Q no/unknown
ZNF628 19 55994445 55994445 Missense_Mutation SNP C T p.R629C no/unknown
ZNF709 19 12574926 12574926 Nonsense_Mutation SNP G A p.R604* no/unknown
ZNF777 7 149129970 149129970 Missense_Mutation SNP C T p.E465K no/unknown
ZNF804A 2 185802926 185802926 Missense_Mutation SNP G A p.E935K no/unknown
ZNF846 19 9868537 9868540 Frame_Shift_Del DEL AATT p.NS405fs no/unknown
ZNF860 3 32032100 32032100 Missense_Mutation SNP A G p.Y510C no/unknown
ZNF862 7 149545150 149545150 Missense_Mutation SNP C G p.L190V no/unknown
ZNRF4 19 5456134 5456134 Nonsense_Mutation SNP C A p.S211* no/unknown